| ENSP00000225655.proc.267485 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000225655.proc.267485 |
| Chromosome | 1 |
| Start Coordinate | 21658745 |
| Stop Coordinate | 21659162 |
| Strand | - |
| Parent Protein | ENSP00000225655 |
| Protein Sequence Start | 140 |
| Protein Sequence Stop | 140 |
| Parent Gene | ENSG00000108518 |
| Fraction | 0.99 |
| Number of Insertions | 3 |
| Number of Deletions | -- |
| Number of Shifts | 3 |
| Number of Stops | -- |
| Identity | 0.77 |
| PolyA | -- |
| Disablements? | Yes |
| Exons | [[21658745, 21659162]] |
| Introns | [] |
| Pseudogene Class | Processed |
| Pseudogene Sequence | GCCAGGTGGACGCCTCTATCTACAGCCTCGTGGCGGATGGGACCTGTTAGGTTCGCGGCCATCGTGGGCAACAAGGACTCACCCTCCATCTGGGCCGCCGTCCCAGGGAAAAACCTTCGTGAACATCACGCCAGCTAAGGTTGGTGTCCTGGTTGGCAAAGACTGGTCAAGCTTTTTCGTGAATAGGCTGACACTGCGGG |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |