| ENSP00000256108.frag.267451 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000256108.frag.267451 |
| Chromosome | 1 |
| Start Coordinate | 11999860 |
| Stop Coordinate | 11999952 |
| Strand | - |
| Parent Protein | ENSP00000256108 |
| Protein Sequence Start | 31 |
| Protein Sequence Stop | 277 |
| Parent Gene | ENSG00000133731 |
| Fraction | 0.11 |
| Number of Insertions | -- |
| Number of Deletions | -- |
| Number of Shifts | -- |
| Number of Stops | 1 |
| Identity | 0.903 |
| PolyA | 3 |
| Disablements? | Yes |
| Exons | [[11999860, 11999952]] |
| Introns | [] |
| Pseudogene Class | Ambiguous |
| Pseudogene Sequence | ATGGCTGATCCTTGGCAGGAATGCATGGATTATGCAGTAACTCTAGCAAGATGAGCTGGAGAGGTAGTTTGTGATGCTCTAAAAAATGAAATG |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |