Yale Pseudogenes (Ensembl 50) :: ENSP00000258169.proc.267486

ENSP00000258169.proc.267486
ViewUCSC Genome Browser
ID ENSP00000258169.proc.267486
Chromosome 1
Start Coordinate 22267420
Stop Coordinate 22267907
Strand -
Parent Protein ENSP00000258169
Protein Sequence Start 160
Protein Sequence Stop 160
Parent Gene ENSG00000135698
Fraction 1.0
Number of Insertions 8
Number of Deletions 2
Number of Shifts 3
Number of Stops 3
Identity 0.709
PolyA --
Disablements? Yes
Exons [[22267420, 22267907]]
Introns []
Pseudogene Class Processed
Pseudogene Sequence ATGGCACCTGAGCACAAGACCAAGTTCTCCAAGAACCTGCTGTACATGAAGTTCATGCAAAGAAGACTGGACTCAGAAACTAAGAAATGACTAGAAGAGGAAGAAAATAAAATTAGTTAAGAGCACTGGTACTCAGATTTGCCAGAGCTTAATAAGTAAAGAATTTCATAACAGAAGAGCAGCATCTCTTGTTATGTGAA
Build 36

Overlapping Annotations
Hoppsigen/1210 (65%)
Human49/ENSP00000258169.proc.267511 (100%)
human53/ENSP00000258169.proc.306067 (100%)
Torrents/224 (100%)

Fragment Browser

Alignments by YASS

Associated Sets
Human Pseudogenes