| ENSP00000263697.frag.267507 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000263697.frag.267507 |
| Chromosome | 1 |
| Start Coordinate | 28400349 |
| Stop Coordinate | 28400468 |
| Strand | - |
| Parent Protein | ENSP00000263697 |
| Protein Sequence Start | 253 |
| Protein Sequence Stop | 253 |
| Parent Gene | ENSG00000126698 |
| Fraction | 0.16 |
| Number of Insertions | -- |
| Number of Deletions | -- |
| Number of Shifts | -- |
| Number of Stops | -- |
| Identity | 1.0 |
| PolyA | -- |
| Disablements? | No |
| Exons | [[28400349, 28400468]] |
| Introns | [] |
| Pseudogene Class | Ambiguous |
| Pseudogene Sequence | GAAAGTCGAGATGGTCGTGTGGACAGCTGGCGAAACTTCCAAGCCAATACGAAGGGGAAGAAAGAGAAGAAAAATCGGACCTTCCTGAGACCACCGAAAGTAAAAATGGAGCAACGTGAG |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |