Yale Pseudogenes (Ensembl 50) :: ENSP00000306362.proc.267464

ENSP00000306362.proc.267464
ViewUCSC Genome Browser
ID ENSP00000306362.proc.267464
Chromosome 1
Start Coordinate 14891212
Stop Coordinate 14891490
Strand -
Parent Protein ENSP00000306362
Protein Sequence Start 108
Protein Sequence Stop 108
Parent Gene ENSG00000171530
Fraction 0.86
Number of Insertions --
Number of Deletions --
Number of Shifts --
Number of Stops 1
Identity 0.849
PolyA 3
Disablements? Yes
Exons [[14891212, 14891490]]
Introns []
Pseudogene Class Processed
Pseudogene Sequence GTTTGCAGGTCGGTCAAAGAAAAACTGACGTATGGAAAAGAAGCAAAATAACAAGAAGAAAAGATCGAAAAAATGAGAGCCGAAGATGGTGAAAATTATGCCATTAAAAAGCAGGCAGAGATCCTACAAGAATCCCAGATGATGATCCCAGATTGCCAGCGCAGGTTGGAAGCTGCATATTTGGATCTTCAACAGATGTT
Build 36

Overlapping Annotations
Havana/OTTHUMG00000037853 (57%)
Human49/ENSP00000306362.proc.267486 (100%)
human53/ENSP00000306362.proc.306045 (100%)
Torrents/168 (39%)

Fragment Browser

Alignments by YASS

Associated Sets
Human Pseudogenes