| ENSP00000318646.proc.267481 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000318646.proc.267481 |
| Chromosome | 1 |
| Start Coordinate | 21202626 |
| Stop Coordinate | 21203015 |
| Strand | - |
| Parent Protein | ENSP00000318646 |
| Protein Sequence Start | 130 |
| Protein Sequence Stop | 130 |
| Parent Gene | ENSG00000134419 |
| Fraction | 1.0 |
| Number of Insertions | 6 |
| Number of Deletions | 4 |
| Number of Shifts | 2 |
| Number of Stops | 2 |
| Identity | 0.716 |
| PolyA | 2 |
| Disablements? | Yes |
| Exons | [[21202626, 21203015]] |
| Introns | [] |
| Pseudogene Class | Processed |
| Pseudogene Sequence | ATCGTGTATATGAATGTTCTGGTTGATGCTCTCAGGAGCGTCAGCAATACTGAATAGAGAGGTAACCACCAGAGTCTTACTAGGTCATGCTTTCCTGTTTCTAACCATGATGATGAGGCATGATAAGGCAATTTACATTGGCAAATTTGAAATCATTGATGATCAGAGAGCAGGGAAAATTGTTGTGAACCTCACAGGCA |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |