| ENSP00000327209.frag.267483 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000327209.frag.267483 |
| Chromosome | 1 |
| Start Coordinate | 21610542 |
| Stop Coordinate | 21611070 |
| Strand | - |
| Parent Protein | ENSP00000327209 |
| Protein Sequence Start | 1427 |
| Protein Sequence Stop | 2240 |
| Parent Gene | ENSG00000178104 |
| Fraction | 0.08 |
| Number of Insertions | 1 |
| Number of Deletions | -- |
| Number of Shifts | 1 |
| Number of Stops | -- |
| Identity | 0.92 |
| PolyA | 2 |
| Disablements? | Yes |
| Exons | [[21610542, 21611070]] |
| Introns | [] |
| Pseudogene Class | Ambiguous |
| Pseudogene Sequence | GAGTGTGAGGAGCACAACAGCCTCAAGGAAATGGTCCTGATGGAGGGGCTGTGCTCTAAGCAGGGGTGCCGGGGCTCAACGCTGGCTAGTTCCTCCGAGAGGAAGCCCTTGGAGAACCAGCTAGGGAAGCAGGAAGAGTTCTGGGTATATGGAAAGTCAGAAAACATCTCAGTCCTACGAAAGGACATCAAAGATCTGAA |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |