Yale Pseudogenes (Ensembl 50) :: ENSP00000335636.proc.267511

ENSP00000335636.proc.267511
ViewUCSC Genome Browser
ID ENSP00000335636.proc.267511
Chromosome 1
Start Coordinate 30150302
Stop Coordinate 30150791
Strand -
Parent Protein ENSP00000335636
Protein Sequence Start 178
Protein Sequence Stop 178
Parent Gene ENSG00000173418
Fraction 0.99
Number of Insertions 2
Number of Deletions 14
Number of Shifts 1
Number of Stops --
Identity 0.548
PolyA 3
Disablements? Yes
Exons [[30150302, 30150791]]
Introns []
Pseudogene Class Processed
Pseudogene Sequence ACACTCAGGACCCCCATCTGTGATGACCTGTCCCACTCAGACAACACCAACATGGGTCCACTTACAGAAACTTTGTACTTACAGAACCTCACCCACTGGCCAGAGTATTTGATAGCTACAGAGGTGCTTGGAGAGCTTATGGGTCACATGATGGGTAAAATAAATGTTTCTCTCGTAGCTAGGGAAGAATTTCCCAGGCA
Build 36

Overlapping Annotations
Human49/ENSP00000335636.proc.267552 (100%)
human53/ENSP00000335636.proc.306092 (100%)
Torrents/274 (90%)

Fragment Browser

Alignments by YASS

Associated Sets
Human Pseudogenes