| ENSP00000341345.frag.267429 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000341345.frag.267429 |
| Chromosome | 1 |
| Start Coordinate | 731021 |
| Stop Coordinate | 731143 |
| Strand | - |
| Parent Protein | ENSP00000341345 |
| Protein Sequence Start | 67 |
| Protein Sequence Stop | 291 |
| Parent Gene | ENSG00000147364 |
| Fraction | 0.14 |
| Number of Insertions | -- |
| Number of Deletions | -- |
| Number of Shifts | -- |
| Number of Stops | -- |
| Identity | 0.805 |
| PolyA | -- |
| Disablements? | No |
| Exons | [[731021, 731143]] |
| Introns | [] |
| Pseudogene Class | Ambiguous |
| Pseudogene Sequence | CTCTTCCAGAGGCATGGCTATTGCACCTTGGGAGAAGCCTTTAATCGGTTAGACTTCTCAAGTGCAATTCAAGATATCCGAAGGTTCAATTATGTGGTCAAAGTAAGTGTTCTATTTCAAAAA |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |