| ENSP00000370884.proc.267473 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000370884.proc.267473 |
| Chromosome | 1 |
| Start Coordinate | 16719816 |
| Stop Coordinate | 16720342 |
| Strand | - |
| Parent Protein | ENSP00000370884 |
| Protein Sequence Start | 192 |
| Protein Sequence Stop | 193 |
| Parent Gene | ENSG00000215863 |
| Fraction | 0.88 |
| Number of Insertions | 8 |
| Number of Deletions | -- |
| Number of Shifts | 1 |
| Number of Stops | -- |
| Identity | 0.67 |
| PolyA | -- |
| Disablements? | No |
| Exons | [[16719816, 16720342]] |
| Introns | [] |
| Pseudogene Class | Processed |
| Pseudogene Sequence | CTTGATTTCCACTCTCAGGGCTCTTCAAAGGACTAAAAGCTAAAGGCGACGATGAATTCATTCCACAAGTCCTAGTCGTGCGCCCTGGTGAGTACCAGACCCTGCTCCCCGCGAGGGGACCCACGAGCGACCCTCACCACCATCCCTGCCCTGGTGGAGCCCCCGTGCGGAACACAGGATCCGAAGATGGCAGCGGAAGC |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |