Yale Pseudogenes (Ensembl 50) :: ENSP00000372234.dup.267417

ENSP00000372234.dup.267417
ViewUCSC Genome Browser
ID ENSP00000372234.dup.267417
Chromosome 1
Start Coordinate 125578
Stop Coordinate 127574
Strand -
Parent Protein ENSP00000372234
Protein Sequence Start 259
Protein Sequence Stop 259
Parent Gene ENSG00000206082
Fraction 1.0
Number of Insertions 3
Number of Deletions --
Number of Shifts --
Number of Stops --
Identity 0.94
PolyA --
Disablements? No
Exons [[125578, 126036], [127194, 127574]]
Introns [[126037, 127193]]
Pseudogene Class Duplicated
Pseudogene Sequence ATGGTCTCCGGTCGGTGGGCTCCTCCACGCCAAGGTTGGGCCTCCCGGCGACCGCCGCAGGCCCAAGTTGTCCTGAAGTCGGGCTCTCCCGGCCCTGCCTCCCAGCAAGTAAGCAAGCTCTTTTGGCTCAACTCCTGCCCAGCTCCCAACCGCCTTTGTAGGCCCCGAACTTTCTCCAGCCAAGCTCTGAGGGCCCACCT
Build 36

Overlapping Annotations
Human49/ENSP00000372165.dup.267419 (63%)
Human49/ENSP00000363678.proc.267420 (58%)
Human49/ENSP00000343312.proc.268394 (29%)
human53/ENSP00000372234.dup.306000 (100%)

Fragment Browser

Alignments by YASS

Associated Sets
Human Pseudogenes