| ENSP00000380635.frag.267494 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000380635.frag.267494 |
| Chromosome | 1 |
| Start Coordinate | 26419446 |
| Stop Coordinate | 26419563 |
| Strand | - |
| Parent Protein | ENSP00000380635 |
| Protein Sequence Start | 102 |
| Protein Sequence Stop | 197 |
| Parent Gene | ENSG00000214087 |
| Fraction | 0.19 |
| Number of Insertions | 2 |
| Number of Deletions | -- |
| Number of Shifts | 1 |
| Number of Stops | -- |
| Identity | 0.872 |
| PolyA | -- |
| Disablements? | Yes |
| Exons | [[26419446, 26419563]] |
| Introns | [] |
| Pseudogene Class | Ambiguous |
| Pseudogene Sequence | ATAGGTGGAAATCTTACTGACATCGTGGCACACAGAAAGATCACCATCCGGGAGCTGGCGGGGGTGGTGCATGGGCCCCATCTGGTCCAGTTACTATGGAAACTGTCATTCTCTCCTG |
| Build | 36 |
|  |
Fragment Browser
Alignments by YASS| Associated Sets |
|---|
| Human Pseudogenes |