Yale Pseudogenes (Ensembl 50) :: ENSP00000382250.proc.267495

ENSP00000382250.proc.267495
ViewUCSC Genome Browser
ID ENSP00000382250.proc.267495
Chromosome 1
Start Coordinate 26462119
Stop Coordinate 26462558
Strand -
Parent Protein ENSP00000382250
Protein Sequence Start 185
Protein Sequence Stop 186
Parent Gene ENSG00000214955
Fraction 0.83
Number of Insertions 4
Number of Deletions 7
Number of Shifts 4
Number of Stops 2
Identity 0.677
PolyA --
Disablements? Yes
Exons [[26462119, 26462558]]
Introns []
Pseudogene Class Processed
Pseudogene Sequence GCCACTTCCAGGTCCCTGCCATCCTGCTCCTTTGCTTCCCGGGAACCATCCCAGTTCTGAGCCGCCCACCAAGCCCTTGGGAATGCCTGGCTATAAGCTGGCTTTAATCTTGACAGCCATGCCGCAGCCAGAGACTACTGCTGCTTTGAAAAGTATGATACAAGCCCTGATGAACAGAGGAGCAATAGTGAGGGACTTGC
Build 36

Overlapping Annotations
Human49/ENSP00000382250.proc.267527 (100%)
human53/ENSP00000382250.proc.306076 (100%)
MRP/38 (100%)
Torrents/243 (79%)

Fragment Browser

Alignments by YASS

Associated Sets
Human Pseudogenes