Yale Pseudogenes (Ensembl 50) :: ENSP00000382707.proc.267491

ENSP00000382707.proc.267491
ViewUCSC Genome Browser
ID ENSP00000382707.proc.267491
Chromosome 1
Start Coordinate 25324137
Stop Coordinate 25324532
Strand -
Parent Protein ENSP00000382707
Protein Sequence Start 132
Protein Sequence Stop 133
Parent Gene ENSG00000142089
Fraction 0.99
Number of Insertions --
Number of Deletions --
Number of Shifts --
Number of Stops 1
Identity 0.811
PolyA 3
Disablements? Yes
Exons [[25324137, 25324532]]
Introns []
Pseudogene Class Processed
Pseudogene Sequence ATGAACCACACTGCCCAAACCTTCTTCACTCCCGCCAACACCGGCTGCCCCCTAGACTATCAGATGCTCAAGTAGGAGCATGAGGTGGCTGTGCTGGGGGCACCCCACAACTCTGCTCCCCCGAGGTCCACCGTGATCCACATCCACAGCGAGACCTCTGTGCCCAACCATGTTGTCTGGTCCCTGTTCAACACCCTCTT
Build 36

Overlapping Annotations
Havana/OTTHUMG00000003319 (98%)
Hoppsigen/305 (70%)
Human49/ENSP00000382707.proc.267522 (100%)
human53/ENSP00000382707.proc.306072 (100%)
Torrents/232 (89%)

Fragment Browser

Alignments by YASS

Associated Sets
Human Pseudogenes